All reactions were conducted in 50 μL volume containing PCR buffer with 1.5 mM MgCl2, 0.2 mM dNTP, 0.5 μM each of primers pA (AGAGTTTGATCCTGGCTCAG) and pH (AAGGAGGTGATCCAGCCGCA) according to Edwards et al. (1989), 0.6 μL of dimethyl sulfoxide and 1.25 U of Taq polymerase (Qiagen TAQ PCR Core Kit). PCR was performed using a Mastercycler ep S gradient thermocycler (Eppendorf, Canada) PLX4032 in vivo with the following conditions: 5 min at 94 °C, followed by 29 cycles of 30 s at 94 °C, 30 s at 58 °C and 1 min at 72 °C, and finally one cycle of 7 min at 72 °C. PCR amplicons were

sequenced at the Genome Quebec Innovation Center (Montreal, Canada). Escherichia coli cells and sterile water were, respectively, used as positive and negative controls. Sequences were identified by blast nucleotide searches in the NCBI website, and the seven different sequences obtained were deposited in the EMBL database under accession numbers FN668006–FN668012. The phylogenetic tree was inferred using the maximum likelihood method based on the Tamura–Nei model in mega software with 1000 bootstrap replicates (Tamura et al., 2007). Three washed G. irregulare spores

isolated from soil were individually directly placed in a PCR tube, and the 16S rRNA gene was amplified using a nested-PCR protocol. A first round using pA and pH primers (Edwards et al., 1989) and a second round using primers 968-GC/1378 (Heuer et al., 1997) amplified approximately a 500-bp fragment corresponding to the hypervariable regions V6–V9. Bacterial biodiversity was assessed by running the amplicons through denaturing gradient gel electrophoresis (DGGE), as described Veliparib in Yergeau et al. (2007) with a 45–65% denaturant gradient using a DCode Universal Mutation Detection System (BioRad). Based on the approach described in St-Arnaud et al. (1995), two-compartment Petri dishes were prepared as described above, except that after solidification of the gel, sterile microscope coverslips were placed along

the central wall, and a further 3 mL of gellified sterile Lck water was poured over the edge of coverslips to form a bridge helping the fungus to cross (Fig. 1). Plates received transformed carrot roots inoculated with G. irregulare in the compartment filled with M medium and the roots were regularly trimmed to avoid any crossing into the second compartment, where only the hyphae were allowed to grow. When hyphae grew over the coverslip, they were inoculated with various bacterial isolates from cultures grown in a liquid tryptic soy broth medium for 24 h. All bacterial cells were rinsed and the concentrations were adjusted to 106 CFU mL−1 with a sterile 0.9% NaCl solution before use. A 150-μL aliquot of each bacterial suspension was deposited directly on the top of the coverslip where hyphae were growing. Each bacterial isolate was replicated five times and the controls included E.