Further validation was also performed by amplifying DNA from some of the samples using primers CCTGGACGTGGATGGGTACT and GGCTC AGGGTCAATCACAGAA and sequencing with primer TCGTGCCTGTCGTGTACTGAA. rs8099917 was genotyped using a predesigned TaqMan SNP Genotyping Assay (Applied Biosystems; assay ID C__11710096_10). The genotyping assay was validated by amplifying DNA from several of the samples using primers TTGTCACTGTTCCTCCTTTTGTTTT and GGCCCTAACTGATACGCTATAATTAAA and sequencing with primer AATGCAAATGAGAGATAATGGTAAGACAT. The

Statistical Package for the Social Sciences (SPSS; version 16) was used for all analyses except for Hardy-Weinberg equilibrium calculations, for which http://ihg2.helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl was used. Genotype distributions were compared using χ2 tests. ALT was normalized by dividing female patients’ measurements by 35 and male patients’ measurements selleck compound by 50 and was used as a continuous DAPT in vitro variable. Association with normalized ALT was determined using nonparametric Mann-Whitney U test or by the Student t test and log10-transformed values of normalized ALT. Similarly, association of genotype with continuous baseline viral load was determined using nonparametric Mann-Whitney U test or by Student t test and log10-transformed values for viral load. In multivariate analysis, log10(normalized ALT) was used.

Binary logistic regression was used to control for variables based on the results from the univariate analyses, hypothesized relationships, and published literature. Binomial confidence intervals were calculated

using http://statpages.org/confint.html. The overall SVR to PEG-IFN/ribavirin therapy was high (80%) as expected in patients infected with HCV genotype 3 who completed the course of therapy. The 281 included patients had a median age of 38 years (range, 18-58) and 59% were male. In univariate analysis, determinants of sustained response to PEG-IFN/ribavirin were younger age (<40 years), absence of advanced fibrosis (APRI < 1.5), low baseline viral load (<4 × 105 IU/mL), and rapid viral response to PEG-IFN/ribavirin therapy (Table 1). In multivariate analysis, MCE age, RVR, and absence of advanced fibrosis, but not baseline viral load, remained associated with higher odds of sustained viral response. Adjusted odds ratios (ORs) for independent variables that remained statistically significant are shown in Table 1. Patients were stratified according to recently identified SNPs near the IL28B gene: rs12979860 and rs8099917. We found no significant difference in SVR to PEG-IFN/ribavirin if patients had the earlier reported responder genotype CC, compared to CT/TT at the rs12979860 locus or if they had the earlier reported responder genotype TT, compared to GT/GG at the rs8099917 locus (Table 2). However, patients with CC at rs12979860 had a lower rate of SVR compared to patients with TT (77% versus 96%, P = 0.038).