We found that, in contrast to M1 macrophages, M2 macrophages overexpressed Wnt ligands and activated Wnt signalling pathways in epithelial cells which reduced markers http://www.selleckchem.com/products/tofacitinib-cp-690550.html of differentiation. In the damaged mucosa of UC patients the number of M2 macrophages increased with chronicity and it was associated with activation of Wnt signalling pathways and diminution in enterocyte differentiation. Material and Methods Cell culture Caco-2 cells (American Type Culture Collection, VA, USA) were cultured in MEM medium (Sigma-Aldrich) supplemented with 20% inactivated bovine foetal serum, 100 U/ml penicillin,100 ��g/ml streptomycin, 2 mM L-glutamine, 100 mM sodium pyruvate and 1% of non-essential amino acids.

HT29 (American Type Culture Collection, VA, USA) were cultured in McCoy��s Medium Modified (Sigma-Aldrich) supplemented with 10% inactivated bovine foetal serum, 100 U/ml penicillin, 100 ��g/ml streptomycin and 2 mM L-glutamine. When appropriated, epithelial cells were treated with exogenous Wnt1 (20ng/ml, Sigma-Aldrich). U937 human monocytes (European Collection of Cell Culture, Salisbury, UK) were cultured in RPMI medium (Sigma-Aldrich CO, St. Louis, MO) with 10% inactivated bovine foetal serum (FBS, Lonza, Basel, Switzerland), 100 U/ml penicillin and 100 ��g/ml streptomycin. U937 monocytes were differentiated into macrophages by culturing them in the presence of phorbol-12-myristate-13-acetate (PMA, Sigma-Aldrich) for 48 h[17]. U937-derived macrophages were stimulated with LPS (0.1��g/ml; E. coli 0111:B4) and IFN-�� (20 ng/ml) or with IL-4 (20 ng/ml) in order to polarize them towards M1 or M2 phenotypes, respectively.

To determine the most effective period GSK-3 for polarization the expression of several markers was analyzed at different time points (0, 8, 24, 48, 72, and 96 hours). RNA interference and cellular transfection U937-derived macrophages cells were transfected with a vector-targeting human Wnt1 (miWnt1, targeting sequence: 5��TGACTTGTTAAACAGACTGCGAA3��, GenBank Accession No. “type”:”entrez-nucleotide”,”attrs”:”text”:”NM_005430″,”term_id”:”219842272″,”term_text”:”NM_005430″NM_005430) or a non-targeting control vector (mock). Lipofectamine-2000 (Invitrogen Life Technologies, Barcelona, Spain) was employed as a transfection reagent and used as previously reported [18]. Sixteen hours post-transfection macrophages were polarized into M2 macrophages as described above. The efficiency of transfection was determined by analyzing the Wnt1 mRNA expression by qPCR. Co-culture Caco-2 cells were co-cultured with U937-macrophages using Transwell? inserts (Corning Incorporated, MA, USA) with a 0.4 ��m porous membrane [18]. U937-derived macrophages were seeded on the inserts and differentiated properly.