fumigatiaffinis and A. lentulus [7, 8], whereas A. fumigatus is usually susceptible to the antifungals that are available for clinical treatment [19, 20]. Few clinical cases of invasive aspergillosis have been reported in which the antifungal treatment was repeatedly modified until the correct identification of the fungal agent and the administration of the appropriate antifungal treatment [17, 18]. Considering that A. fumigatus may represent a considerable part of all clinical cases of aspergillosis, molecular characterization is essential for the correct identification of species within the learn more section Fumigati. In this study, we developed a multiplex PCR strategy that was able

to differentiate A. fumigatus from all the other related species within the section Fumigati. GANT61 nmr We could not test all of the species of section Fumigati, as some of them are extremely rare. However, we believe that the present multiplex PCR can be widely used, as A. lentulus is more closely related to A. fumigatus than most species in section Fumigati (e.g. A. viridinutans) [4, 5], and a distinct electrophoretic profile was observed with two strains

of this species. It is expected that other species of section Fumigati that are genetically distant from A. fumigatus can be distinguished by employing mTOR kinase assay this multiplex PCR (see additional file 2 in supplemental data). A simple electrophoresis profile after PCR amplification clearly separates two species, A. fumigatus and N. udagawae, from a second group of fungal isolates of section Fumigati. This method is furthermore amenable to automation. Compared to previously described methodologies for A. fumigatus identification within its section [10–13], the proposed method facilitates the molecular recognition of this species by employing a single multiplex PCR and avoiding the need for restriction enzymes and specialized Telomerase equipment. This approach is cheap and simple and would be very useful

in clinical labs that routinely screen and perform the molecular identification of several mould isolates. The proposed new assay proved to be specific and highly reproducible for targeting A. fumigatus within the section Fumigati and outside this section. A list of fungal species related to A. fumigatus could be identified by sequencing partial regions of βtub and rodA. A group of 14 unique species and two groups of species of section Fumigati were distinguished by point mutations in βtub and rodA. This work presents the first record of polymorphic sites available for the rapid identification of species within the section Fumigati following the analysis of more than 450 βtub and rodA sequences. This list represents a practical guide for the molecular recognition of rare fungal species, and it can certainly be expanded in the near future when more sequences of βtub and rodA are available.

arXiv:0803.4258. 2008. cond-mat.mtrl-sci. Competing interests The authors declare that they have no competing interests. Authors’ contributions AY and DC carried out the sample preparation, participated on its analysis, performed all the Analyses, and wrote the paper. XL and JL helped perform

the XRD and EDS analyses. SL guided the study and participated in the paper correction. All authors read and approved the final manuscript.”
“Background Er-doped silica-based materials have been extensively studied in the field of optical communication technology for their promising applications as active elements in photonic devices [1–4]. Indeed, the sharp luminescence of Er3+ ions at 1.54 μm matches the standard telecommunication wavelength of silica optical fibers and is absorption-free for Si bandgap. However, the Er3+ luminescence efficiency in silica check details is too low to be practical,

and an expensive and bulky laser tuned to an Er3+ absorption band is required for the excitation of the Er3+ luminescence. Consequently, Si nanoclusters (Si NCs) with large excitation Ipatasertib purchase cross-section and broad excitation band are exploited as sensitizers to improve the excitation efficiency of Er3+[5, 6]. Great deals of researches have committed effort to improve the properties of sensitizers (Si NCs) and to enhance the luminescence efficiency of Er3+[7–9]. As for the Si NCs, both experimental and theoretical studies indicate that the microstructures, especially the interfaces

of Si NCs, play an active role in their optoelectronic properties [10–12]. Furthermore, the optical properties of Si NCs would also be affected by the coalescence of Si NCs, which is universal in silicon-rich oxide (SRO) matrix with sufficient Si excess and long-time post-annealing process [13, 14]. However, there still exist incomprehension and uncertainties regarding the influence of microstructures of Si NCs on the Er3+ optical properties despite of the extensive studies on the sensitization process of Si NCs for Er3+. In this letter, we report on the effect of microstructure evolution of Si NCs on the Er-related luminescence in erbium-doped Tryptophan synthase SRO (SROEr) films. We address in a conclusive way that the coalescence of Si NCs in microstructures would reduce the luminescence of Si NCs, which would further quench the luminescence of Er3+. These results GW786034 molecular weight reveal that separated Si NCs are needed to obtain efficient Er3+ luminescence. Methods SRO (SROEr) films were deposited on p-type silicon substrates by the sputtering (co-sputtering) of a pure Si target or Er2O3 and Si targets in the plasma of Ar-diluted 1% O2 atmosphere, where the amount of Si excess and the Er concentration were modulated by varying the r.f. power from 80 to 160 W for Si and from 15 to 20 W for Er2O3, respectively. The samples with Si excesses of 11%, 36%, 58%, and 88%, and Er concentration of about 5×1019 at.

Some of these systems provide young surgeons with satisfactory theoretical and practical instructional backgrounds for the emergency surgery field. However, other less fortunate formative systems lack

the support and training opportunities necessary to foster competent surgeons. If research were to be conducted, the results would inevitably demonstrate that the most stagnant and inflexible systems exist where there is the least amount of opportunities to learn and practice as a developing surgeon. This is common sense and hardly newsworthy, but it has dramatic implications for those dedicated and capable individuals who wish to improve their surgical skills, yet are hindered by such dysfunctional preparatory check details systems. The main problem is that certain systems do not mandate a minimum theoretical and practical understanding of a given field, whether initially during general surgery exercises or later during specialization. This instructional laxity is absolutely unacceptable and presents a notable hazard for the EU, considering

that surgical certifications are selleck products reciprocally recognized Selleck Go6983 between programs within all EU states. Every high-risk endeavour requires uniform preparation and training for its respective operatives, just as it is for the standardized emergency protocols regarding airports and airplanes. In this way, standardized courses of action are indoctrinated, thereby encouraging sensible responses when stressful environments prevent one from making calm, calculated decisions on an individual basis. Everyone

would benefit from a unified system throughout the EU, one that has been scrupulously cross-examined by different parties to ensure high treatment standards. This could only be achieved by actively preparing medical students, the future doctors of tomorrow, for such a significant institutional transition. One of the main problems of the aforementioned of “”lax system”" is the absolute, incontestable authority conferred to its directors, a jurisdiction that can never be effectively challenged or disputed by surgeons in training. Furthermore, surgical students cannot choose between programs. Young impressionable surgeons are often forced to remain in the same facility for the duration of the formative program without having the opportunity to experience different systems and techniques, even if the instruction they receive is clearly inadequate. There is no independent oversight governing these programs and consequently no one is ever truly held accountable. Often, the very instructors themselves are the only individuals that scrutinize performance reviews, consider suggestions, or investigate complaints. The EU as an institution has already experienced great political and economic success by embracing the poorer European states alongside their wealthier counterparts, thereby spreading prosperity across the continent.

Eur J Gastroenterol Hepatol 2007, 19:769–774.PubMedCrossRef 46. Kim K, Rhim T, Choi I, Kim S: N-acetylcysteine induces cell cycle arrest in hepatic stellate cells through its reducing activity. J Biol Chem 2001, 276:40591–40598.PubMedCrossRef 47. Chen GQY, Yao J, Jiang Q, Lin X, Chen F, Lin F, Lin M, Lin Smoothened Agonist chemical structure L, Zhu P: Construction of NF-kappaB-targeting RNAi adenovirus vector and the effect of NF-kappaB pathway on proliferation and apoptosis of vascular endothelial cells. Mol Bio Rep 2010, 38:3089–3094.CrossRef 48. Schubert S, Neeman I, Resnick N: A novel mechanism for the inhibition of NF-kappaB

activation in vascular endothelial cells by natural antioxidants. FASEB J 2002, 16:1931–1933.PubMed 49. Vercelino R, Crespo I, de Souza G, Cuevas M, de Oliveira M, Marroni N, González-Gallego J, Tuñón M: S-nitroso-N-acetylcysteine attenuates liver fibrosis in cirrhotic rats. J Mol Med 2010, 88:401–411.PubMedCrossRef 50. Havre P, O’Reilly S, McCormick J, Brash D: Transformed and tumor-derived human cells exhibit preferential sensitivity to

the thiol antioxidants, N-acetyl cysteine and penicillamine. Cancer Res 2002, 62:1443–1449.PubMed 51. Ohata K, Ichikawa T, Nakao K, Shigeno M, Nishimura D, Ishikawa H, Hamasaki selleck chemical K, Eguchi K: Interferon alpha inhibits the nuclear factor kappa B activation triggered by X gene product of hepatitis B virus in human hepatoma cells. FEBS Lett 2003, 553:304–308.PubMedCrossRef 52. Alexopoulou L, Holt A, Medzhitov R, Flavell R: Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 2001, 413:732–738.PubMedCrossRef 53. Manna S, Mukhopadhyay

A, Aggarwal B: IFN-alpha suppresses activation of nuclear transcription factors NF-kappa Histidine ammonia-lyase B and activator protein 1 and potentiates TNF-induced apoptosis. J Immunol 2000, 165:4927–4934.PubMed 54. Bassères D, Baldwin A: Nuclear factor-kappaB and inhibitor of kappaB kinase pathways in oncogenic initiation and progression. Oncogene 2006, 25:6817–6830.PubMedCrossRef Competing interest The DZNeP mw Authors declare that they have no competing interests. Authors’ contributions NAK made all experiments, data analysis and wrote the paper, EC had worked in cytometry analysis and results discuss, UM gave the laboratory supply and help in on the discussion of results and review the paper, NM gave the financial support and laboratory supply and CAM helped in article writing and revision of data. All Authors read and approved the final manuscript.”
“Background Reestablishment of liver volume after resection is probably regulated by the functional needs of the organism, as the liver regeneration process terminates when the normal liver-mass/body-weight ratio of 2.5% has been restored.

Nano Res 2012, 5:235–247.CrossRef 17. Hong SS, Cha JJ, Cui Y: One nanometer resolution electrical probe via atomic metal filament formation. Nano Lett 2011, 11:231–235.CrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions MT performed all the AFM measurements and wrote the manuscript. HF and SH developed the

technology behind the sample preparation and consequently prepared the samples. Corrections to the manuscript were also provided. SS, TG and MH put the basis of the entire project, guided the internal collaboration, and read and improved the manuscript. All authors read and approved the final manuscript.”
“Background There are a lot of types of nanoparticles and colloidal particles in groundwater [1]. SBI-0206965 mw Some of them are formed naturally, others are Selleck Ferrostatin-1 generated synthetically and put into the ground by humans. Not only is the reactivity of particles important, but also their migration properties are examined. For example, natural bentonite colloids are released as a consequence of bentonite disposal of radioactive wastes and could carry adsorbed radionuclides in groundwater through granite [2, 3]. PF01367338 Zero-valent iron nanoparticles are produced [4–6] and injected into the ground. Iron nanoparticles are able to migrate in groundwater through contaminated areas and remediate the polluted soils and water [7]. In the first case, the migration

possibility is unwelcome. In the second case, the better the migration, the more effective of the remediation. That is why a simulation

of the migration of nanoparticles might be desirable. To simulate the migration of nanoparticles, the coefficient of transport retardation of the nanoparticles is needed. The coefficient represents the possible reduction in the over rate of nanoparticle migration compared with nanoparticles with similar properties. The number of nanoparticles with similar properties changes over time due to aggregation and it influences the results of the migration experiments. A dynamic model of aggregation has to be included in the simulation programme of nanoparticle transport in flowing water. That is why mass transport coefficients are needed. The coefficients represent the frequency of nanoparticle collisions [8, 9]. A commonly used model for mass transport coefficients [10, 11] in describing aggregation is based on the collisions among nanoparticles caused by heat fluctuation, the velocity gradient of the water in which the nanoparticles are suspended and the different velocities of sedimentation of nanoparticles of varying size. This model does not include the decrease in the rate of aggregation due to repulsive electrostatic forces which occurs due to the electric double layer which builds up on nanoparticle surfaces [12]. Further, in the case of magnetic nanoparticles, the aggregation rate is rapidly increased due to the attractive magnetic forces between nanoparticles [4, 13–16].

Fifth, a candidate gene encoding a potential acetate uptake system for M. acetivorans was identified (Figure 6). This gene exhibits the same expression patterns as the ack and pta genes needed for activation of the methanogenic substrate following its entry into learn more the cell. Expression of aceP was suppressed by the energetically favorable substrate, methanol (Figure 6B). The AceP protein is predicted to have six transmembrane-spanning alpha-helical regions (Additional file 1, Figure S1). Noteworthy, aceP homologs are present in other methanogens including M. mazei, M. barkeri, M. maripaludis, and M. hungatei, and they constitute

a distinct class of archaea transporters. Related genes are also present in many bacterial species (Additional file 3, Figure S3), suggesting the possibility of a lateral gene transfer event from a bacterium into the Methanosarcina sp. as was proposed as one explanation for their large genome sizes [23]. Experiments are in progress to characterize the membrane function of the M. acetivorans ATM Kinase Inhibitor manufacturer protein since no archaeal or bacterial homologs shown in Additional file 3, Figure S3 have been examined to date. Carbon selleck control in the Archaea Considerable

information is available concerning carbon control of gene expression in bacterial and eukaryal systems, but little is yet known about related carbon control in the Archaea. Few studies have been reported for any archaeal species but include microarray studies in Pyrococcus furiosus [28], M. mazei [29, 30], and M. acetivorans [6]. The present experiments extend these studies to address a larger set of genes needed for carbon flow and electron transfer leading to methane formation from two key methanogenic substrates (Figure 8).

It provides a foundation of RNA transcript abundance and 5′ end data to begin exploring regulatory controls in this organism at the level of regulated mRNA synthesis and turnover. Little is known Verteporfin mouse about the relative contributions of archaea transcription factors, translation factors, and/or small RNA’s in gene regulation in the Methanosarcina species to provide the distinct patterns of gene expression observed here. M. acetivorans clearly maintains a cellular commitment to dynamically control transcript levels in response to methanogenic substrate type where two major gene families are further defined by this study. Conclusion Of the twenty M. acetivorans gene clusters examined in this study, all but four were differentially expressed by 2 to 200-fold during acetate versus methanol cell growth (Figures 1, 2, 3, 4, 5, 6). The majority of these queried genes are present all sequenced Methanosarcina genomes that include M. acetivorans, M. mazei and M. barkeri (Table 1) and include the genes for multiple heterodisulfide reductase and hydrogenase-like enzymes. Exceptions are the echABCDEF, vhoGAC, rnfXCDGEABY, and mrpABCDEFG genes that encode known or predicted electron transfer complexes for ion movement and/or electron transfer.

pylori culture, one each from the antrum, corpus, and cardia. These were stained with haematoxylin and eosin and reviewed for the H. pylori-related histology by the updated Sydney’s system [4, 22, 23]. In addition, the study collected 181 H. pylori isolates for the detection of dupA genotype by PCR. One hundred and three isolates were collected from selleckchem randomly selected patients who had agreed

to undergo SNP analysis, while 78 isolates were from patients without SNP analysis. The H. pylori culture were conducted from the two additional gastric EPZ015938 solubility dmso biopsies collected during the same endoscopy and processed with the method applied in previous publications [4, 22]. For those with positive H. pylori culture, the isolates were extracted for genomic DNA to be analyzed for the dupA genotypes by PCR. The extraction of DNA was done with the same method as described previously [4, 22]. Positive H. pylori infection was defined by positive histology or culture. Genotypes of SNPs in MMPs and TIMPs Peripheral blood 8 ml was obtained from each subject for genomic DNA, which was extracted from peripheral blood mononuclear cells according CBL0137 in vivo to the manufacturer’s instructions (Viogene, Taipei, Taiwan). Five SNPs in

MMP-3-1612 5A/6A, MMP-7-181 A/G, MMP-9exon 6 A/G, TIMP-1372 C/T, and TIMP-2-418 G/C polymorphisms were determined by PCR-RFLP assays [18, 24–26]. Using the extracted DNA as template, the regions of each MMP and TIMP were amplified by PCR using commercially available kits (GoTaq® Green Master Mix, Promega, Madison, WI, USA) following the manufacturer’s instructions. The sequences of primers, PCR conditions, and restriction enzymes (obtained from New England Biosciences, U.S.) used were summarized in Table 1. After digestion, the products were separated by electrophoresis on a 4% agarose gel. The MMP and TIMP genotypes were shown as different gel examples (Figure 1). Table 1 The PCR primers

used in the study SNP/gene Primer sequence (5′ →3′) Size (bp) Restriction enzyme Reference MMP-3 -1612 5A/6A GATTACAGACATGGGTCACG 120 Xmn I Shibata et al, 2005   TTTCAATCAGGACAAGACGAAGTTT   6A: 120 bp         5A: 97 bp + 23 bp   MMP-7 -181 A/G TGGTACCATAATGTCCTGAAT Immune system 150 EcoR I Jormsjö et al, 2001   TCGTTATTGGCAGGAAGCACACAATGAATT   A: 150 bp         G: 120 bp + 30 bp   MMP-9 exon6 A/G CCATCCATGGGTCAAAGAAC 295 Sma I Shibata et al, 2005 *   GGGCTGAACCTGGTAGACAG   A: 295 bp         G: 192 bp + 103 bp   TIMP-1 372 C/T GCACATCACTACCTGCAGTC 175 BssSI Wollmer et al, 2002   GAAACAAGCCCACGATTTAG   T: 175 bp         C: 152 bp + 23 bp   TIMP-2 -418 G/C CGTCTCTTGTTGGCTGGTCA 304 BsoBI Zhou et al, 2004   CCTTCAGCTCGACTCTGGAG   C: 253 bp + 51 bp         G: 230 bp + 51 bp + 23 bp   jhp0917_1 TGGTTTCTACTGACAGAGCGC 307 – Lu et al.

4.24.15. Biochemistry 1990, 29:10323–9.H 89 datasheet PubMedCrossRef 51. Niemirowicz G, Parussini F, Agüero F, Cazzulo JJ: Two metallocarboxypeptidases from the protozoan Trypanosoma cruzi belong to the M32 family, Selleck Doramapimod found so far only in prokaryotes. Biochem J 2007, 401:399–410.PubMedCrossRef 52. Doucet A, Butler GS, Rodriguez D, Prudova A, Overall CM: Quantitative degradomics analysis of proteolytic post-translational modifications of the cancer proteome. Mol Cell Proteomics 2008, 7:1925–1951.PubMedCrossRef 53. Pellé

R, Schramm VL, Parkin DW: Molecular cloning and expression of a purine-specific N-ribohydrolase from Trypanosoma brucei brucei . Sequence, expression, and molecular analysis. J Biol Chem 1998, 273:2118–26.PubMedCrossRef 54. Di Virgilio F, Chiozzi P, Ferrari selleck products D, Falzoni S, Sanz JM, Morelli A, Torboli M, Bolognesi G, Baricordi OR: Nucleotide receptors: an emerging family of regulatory molecules in blood cells. Blood 2001, 97:587–600.PubMedCrossRef 55. Haskó G, Cronstein : Adenosine: an endogenous regulator of innate immunity. Trends Immunol 2004, 25:33–9.PubMedCrossRef 56. Ribeiro JM, Valenzuela JG: The salivary purine nucleosidase of the mosquito, Aedes aegypti

. Insect Biochem Mol Biol 2003, 33:13–22.PubMedCrossRef 57. Gounaris K, Selkirk ME: Parasite nucleotide-metabolizing enzymes and host purinergic signalling. Trends Parasitol 2005, 21:17–21.PubMedCrossRef 58. Opperdoes FR, Borst P: Localization of nine glycolytic enzymes in a microbody-like organelle in Trypanosoma brucei Phospholipase D1 : the glycosome. FEBS Lett 1977, 80:360–4.PubMedCrossRef 59. Albert MA, Haanstra JR, Hannaert V, Van Roy J, Opperdoes FR, Bakker BM, Michels PA: Experimental and in silico analyses of glycolytic flux control in bloodstream form Trypanosoma brucei . J Biol Chem 2005, 280:28306–15.PubMedCrossRef

60. Lay AJ, Jiang XM, Daly E, Sun L, Hogg PJ: Plasmin reduction by phosphoglycerate kinase is a thiol-independent process. J Biol Chem 2002, 277:9062–9068.PubMedCrossRef 61. Veiga-Malta I, Duarte M, Dinis M, Tavares D, Videira A, Ferreira P: Enolase from Streptococcus sobrinus is an immunosuppressive protein. Cell Microbiol 2004, 6:79–88.PubMedCrossRef 62. Huang LJ, Chen SX, Luo WJ, Jiang HH, Zhang PF, Yi H: Proteomic analysis of secreted proteins of non-small cell lung cancer. Ai Zheng 2006, 25:1361–7.PubMed 63. Labbé M, Péroval M, Bourdieu C, Girard-Misguich F, Péry P: Eimeria tenella enolase and pyruvate kinase: a likely role in glycolysis and in others functions. Int J Parasitol 2006, 36:1443–52.PubMedCrossRef 64. Rokeach LA, Zimmerman PA, Unnasch TR: Epitopes of the Onchocerca volvulus RAL1 antigen, a member of the calreticulin family of proteins, recognized by sera from patients with onchocerciasis. Infect Immun 1994, 62:3696–704.PubMed 65. Dupuis M, Schaerer E, Krause KH, Tschopp J: The calcium-binding protein calreticulin is a major constituent of lytic granules in cytolytic T lymphocytes. J Exp Med 1993, 177:1–7.

(XLS 164 KB) References 1. Tarnawski S, Hamelin J, Locatelli L, Aragno M, Fromin N: Examination of Gould’s modified S1 (mS1) selective medium and Angle’s non-selective P505-15 solubility dmso medium for describing the diversity of Pseudomonas spp. in soil and root environments. FEMS Microbiol Ecol 2003, 45:97–104.PubMedCrossRef 2. Browne P, Rice O, Miller SH, Burke J, Dowling DN, Morrissey JP, O’Gara F: Superior inorganic phosphate solubilization is linked to phylogeny within the Pseudomonas fluoresence complex. Appl Soil Ecol 2009, 43:131–138.CrossRef 3. Rajmohan S, Dodd C, Waites W: Enzymes from isolates of Pseudomonas fluorescens involved in food spoilage. J Appl Micro 2002, 93:205–213.CrossRef

4. Mulcahy H, O’Callaghan J, O’Grady EP, Maciá MD, Borrell N, Gómez C, Casey PG, Hill C, Gahan CGM, Oliver A, O’Gara F: Pseudomonas aeruginosa RsmA plays an important role during murine infection by influencing colonization, virulence, persistence and pulmonary inflammation. Infect Immun 2008, 76:632–638.PubMedCrossRef 5. Haritash A, Kaushik C: Biodegradation aspects of polycyclic

aromatic hydrocarbons (PAHs): A review. J Hazard Mater 2009, 169:1–15.PubMedCrossRef 6. Walsh UF, Morrissey JP, O’Gara F: Pseudomonas for biocontrol of phytopathogens: from functional genomics to commercial exploitation. Curr Opin Biotechnol 2001, 12:289–295.PubMedCrossRef 7. Cronin D, Moënne-Loccoz Y, Fenton A, Dunne C, Dowling DN, O’Gara F: Role of 2,4-diacetylphloroglucinol find more in the interactions of the biocontrol see more pseudomonad

Megestrol Acetate strain F113 with the potato cyst nematode Globodera rostochiensis . Appl Environ Microbiol 1997, 63:1357–1361.PubMed 8. Haas D, Défago G: Biological control of soil-borne pathogens by fluorescent pseduomonads. Nat Rev Microbiol 2005, 3:307–319.PubMedCrossRef 9. Miller SH, Browne P, Prigent-Combaret C, Combes-Meynet E, Morrissey JP, O’Gara F: Biochemical and genomic comparison of inorganic phosphate solubilization in Pseudomonas species. Environ Microbiol Rep 2010, 2:403–411.CrossRef 10. Villacieros M, Whelan C, Mackova M, Molgaard J, Sánchez-Contreras M, Lloret J, Aguirre de Cárcer DA, Oruezábal RI, Bolaños L, Macek T, Karlson U, Dowling DN, Martín M, Rivilla R: Polychlorinated biphenyl rhizoremediation by Pseudomonas fluorescens F113 derivatives, using a Sinorhizobium meliloti system to drive bph gene expression. Appl Environ Microbiol 2005, 71:2687–2694.PubMedCrossRef 11. Deutscher J: The mechanisms of carbon catabolite repression in bacteria. Curr Opin Microbiol 2008, 11:87–93.PubMedCrossRef 12. Görke B, Stülke J: Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev 2008, 6:613–624.CrossRef 13. Rojo F: Carbon catabolite repression in Pseudomonas : optimizing metabolic versatility and interactions with the environment. FEMS Microbiol Rev 2010, 34:658–684.PubMed 14. Collier D, Hager P, Phibbs P Jr: Catabolite repression control in the Pseudomonads. Res Microbiol 1996, 147:551–561.PubMedCrossRef 15.