“
“The iron requirements of the opportunistic pathogenic yeast, Candida albicans, and the related

nonpathogenic spoilage yeast Candida vini were investigated along with their responses to various exogenous iron chelators. The influence of iron as well as the exogenous chelating agents lactoferrin, EDTA, deferiprone, desferrioxamine, bathophenanthroline sulphonate and a novel carried chelator with a hydroxypyridinone-like Fe-ligand functionality, DIBI, on fungal growth was studied in a chemically defined medium deferrated to trace iron levels (<1.2 μg L−1 or 0.02 μM of Fe). Candida albicans competed better at low iron levels compared with C. vini, which was also more susceptible to most added chelators. Candida albicans was resistant to lactoferrin at physiologically relevant concentrations, but was inhibited by low Hedgehog antagonist concentrations of DIBI. Candida vini was sensitive to lactoferrin as well as to DIBI, whose inhibitory activity was shown to be Fe reversible. The pathogenic potential of C. albicans and the nonpathogenic nature of C. vini were consistent with their differing abilities to grow under iron-limiting conditions

and in the presence of exogenous iron chelators. Both yeasts could be controlled by appropriately strong chelators. This work provides the first evidence of the iron requirements of the spoilage organism C. vini and its response to exogenous chelators. Efficient iron withdrawal has the potential to provide the learn more basis for Oligomycin A purchase new fungal growth control strategies. Microbial spoilage of foods, beverages and other aqueous consumer products, such as personal care cosmetics or ophthalmic solutions, presents significant challenges for product preservation and may lead to health implications. Traditional techniques involving chemical preservatives to suppress microorganisms can have the limitation of the development of microbial resistances (Russell, 1991; Chapman, 2003) and may not generally be compatible with product formulations

or may lead to undesirable reactions among sensitive consumers (Jong et al., 2007). Fungal spoilage is particularly important, given their propensity for growth at low pH values, as often used to inhibit bacterial growth. Combinations of chemical agents within a so-called hurdle approach to preservation have yielded some improvements (Leistner, 2000). For example, EDTA, which is known to chelate Fe, Ca and various other essential cations (Ueno et al., 1992), has been shown to increase the sensitivities of preservative-tolerant isolates, such as Pseudomonas (Chapman et al., 1998). The underlying iron requirement of microbial growth could provide the basis for a general approach to increasing microbial stability of products.

All reactions were conducted in 50 μL volume containing PCR buffer with 1.5 mM MgCl2, 0.2 mM dNTP, 0.5 μM each of primers pA (AGAGTTTGATCCTGGCTCAG) and pH (AAGGAGGTGATCCAGCCGCA) according to Edwards et al. (1989), 0.6 μL of dimethyl sulfoxide and 1.25 U of Taq polymerase (Qiagen TAQ PCR Core Kit). PCR was performed using a Mastercycler ep S gradient thermocycler (Eppendorf, Canada) PLX4032 in vivo with the following conditions: 5 min at 94 °C, followed by 29 cycles of 30 s at 94 °C, 30 s at 58 °C and 1 min at 72 °C, and finally one cycle of 7 min at 72 °C. PCR amplicons were

sequenced at the Genome Quebec Innovation Center (Montreal, Canada). Escherichia coli cells and sterile water were, respectively, used as positive and negative controls. Sequences were identified by blast nucleotide searches in the NCBI website, and the seven different sequences obtained were deposited in the EMBL database under accession numbers FN668006–FN668012. The phylogenetic tree was inferred using the maximum likelihood method based on the Tamura–Nei model in mega software with 1000 bootstrap replicates (Tamura et al., 2007). Three washed G. irregulare spores

isolated from soil were individually directly placed in a PCR tube, and the 16S rRNA gene was amplified using a nested-PCR protocol. A first round using pA and pH primers (Edwards et al., 1989) and a second round using primers 968-GC/1378 (Heuer et al., 1997) amplified approximately a 500-bp fragment corresponding to the hypervariable regions V6–V9. Bacterial biodiversity was assessed by running the amplicons through denaturing gradient gel electrophoresis (DGGE), as described Veliparib in Yergeau et al. (2007) with a 45–65% denaturant gradient using a DCode Universal Mutation Detection System (BioRad). Based on the approach described in St-Arnaud et al. (1995), two-compartment Petri dishes were prepared as described above, except that after solidification of the gel, sterile microscope coverslips were placed along

the central wall, and a further 3 mL of gellified sterile Lck water was poured over the edge of coverslips to form a bridge helping the fungus to cross (Fig. 1). Plates received transformed carrot roots inoculated with G. irregulare in the compartment filled with M medium and the roots were regularly trimmed to avoid any crossing into the second compartment, where only the hyphae were allowed to grow. When hyphae grew over the coverslip, they were inoculated with various bacterial isolates from cultures grown in a liquid tryptic soy broth medium for 24 h. All bacterial cells were rinsed and the concentrations were adjusted to 106 CFU mL−1 with a sterile 0.9% NaCl solution before use. A 150-μL aliquot of each bacterial suspension was deposited directly on the top of the coverslip where hyphae were growing. Each bacterial isolate was replicated five times and the controls included E.

aureus isolates originating from community and nosocomial sources necessitates the development of new and improved antimicrobial agents for the prevention and treatment of these life-threatening infections (Hall et al., 2003). To date, many studies have focused on naturally occurring compounds

(Smith-Palmer et al., 2004). Our previous research has shown that the MICs of licochalcone A against 27 S. aureus strains ranged from 2 to 8 μg mL−1(Qiu et al., 2009). It is uncommon for compounds isolated from medical plants to have such powerful antimicrobial activities on both Selleckchem GSK3 inhibitor MSSA and MRSA. Consequently, licochalcone A may potentially be used as a lead compound for the design of more potent antibacterial agents (based on the chalcone template) to be used to fight drug-resistant S. aureus strains. On the other hand, an alternative strategy that is now gaining interest to treat with S. aureus infections is the targeting of bacterial virulence factors (e.g. haemolysins, enterotoxins, adhesins) (Song et al., 2009). A number of virulence factors secreted by S. aureus play a significant role in pathogenesis. Therefore, the clinical performance of antibiotics used for the treatment of S. aureus infections not only depends on the respective bacteriostatic or bactericidal effects but also on the ability Selleckchem INK 128 to prevent the release of virulence factors by dying

or stressed bacteria (Bernardo et al., 2004). Previous studies have indicated that enterotoxins secreted by S. aureus are affected by many antibiotics, especially

at suboptimal concentrations. Protein synthesis inhibitors such as linezolid can reduce the expression of S. aureus virulence factors including enterotoxins A and B at subgrowth-inhibitory concentrations (Bernardo et al., 2004). In contrast, β-lactam antibiotics induce or increase enterotoxin production, suggesting that the symptoms of S. aureus ADAMTS5 infections, especially MRSA infections, may be aggravated when patients are treated with these antibiotics (Stevens et al., 2007). Furthermore, it has been shown that some plant compounds (e.g. oleuropein) and plant essential oils (e.g. oils of bay, cinnamon, and clove) can also influence the production of enterotoxins when used at subinhibitory concentrations (Tranter et al., 1993; Smith-Palmer et al., 2004). The antibiotic-induced regulation of virulence factors may result in either aggravation or attenuation of the disease. Therefore, the up- or downregulation of toxin secretion is significant for diseases caused by S. aureus, and the ability of antibiotics to affect these properties may be an important criterion in selecting an antibiotic for therapy (Blickwede et al., 2005). In this study, licochalcone A was shown by Western blot assay, TNF release assay, murine T-cell proliferation assay, and real-time RT-PCR to repress SEA and SEB secretion by S. aureus in a dose-dependent manner. The expression of most virulence factors by S.

Double restriction digests

were carried out using restriction PD0325901 manufacturer enzymes EcoRI and RsaI or EcoRI and DdeI (Fermentas, Vilnius, Lithuania). Two microlitres of 100 μg mL−1 RNase (Promega, Madison, WI) was added to each reaction. Restriction digests were incubated at 37 °C for 16 h and analysed by agarose gel electrophoresis. Gels were stained with ethidium bromide to enable the visualisation of the DNA fragments using UV transillumination. Different RFLP types were assigned manually. DNA sequences obtained in this study were aligned in ARB (Ludwig, et al., 2004) together with all other available cmuA sequences using the integrated aligner, and the resulting alignments were edited manually. Primer sequences were removed and the remaining sequences translated to amino acid sequence, resulting in a 252-residue alignment (min 251, max 252, mean 251.99); the presence of conserved functional amino acid residues was confirmed, before export of the alignment from ARB. FastTree [version 2.1.3 (Price et al., 2010)] was used to construct Belinostat in vitro nearest neighbour interchange neighbour-joining trees rapidly with the

parameters -spr 4, -mlacc 2 and -slownni, increasing the number of rounds of minimum-evolution subtree pruning and regrafting moves and making the maximum-likelihood nearest neighbour interchanges more exhaustive in order to increase the accuracy of the tree. The tree was imported into ARB, where it was annotated and rooted with reference to AJ011316 Methylobacterium chloromethanicum strain CM4. PCR products of the expected size (~ 807 bp) were only obtained from three of the nine cruise stations where SAPs had been used to concentrate large volumes of seawater for DNA extraction; faint PCR products were obtained from stations 1, 4 and 9. Libraries of 50 cmuA

clones were produced from each of the PCR products. Clones were assigned to different RFLP pattern types by RFLP analysis with EcoRI/DdeI and EcoRI/RsaI double digests. The station 1 cmuA library was shown to contain only two OTUs; 70% of clones belonged to OTU 1 and 30% to OTU 2. The station 4 clone library was dominated by OTU 3 (98%) with a single clone designated OTU 4. Station Wilson disease protein 9 was similarly dominated, with 100% of clones affiliated by RFLP to OTU 3. Representatives of each OTU were sequenced and deposited in GenBank with the accessions DQ090698–DQ090705. The faint PCR products and low diversity of cmuA sequences obtained from the large-volume SAP DNA samples indicated that these organisms were probably a small component of the microbial community. We attempted enrichment of methyl halide-utilising bacteria in seawater samples from both the Arabian Sea and the English Channel near Plymouth, UK, in order to increase their relative abundance. Enrichment cultures with different concentrations of CH3Br and CH3Cl, either alone or together with a range of one-carbon (C1) compounds (see ‘Materials and methods’ for details), were set up during the AMBITION cruise.

It is likely that other OmpR-dependent adherence factors are missing in the ompR mutant. It has previously been shown that cells of the ompR mutant AR4 lack YompF and YompC porins in the outer membrane (Brzostek et al., 2007), and the latter protein may play a role in microbial attachment to eukaryotic cells (Brzostek & Raczkowska, 2007). These observations suggest that YompC might partially mediate the adhesion of Y. enterocolitica to HEp-2 cells. The results of invasion assays performed without the centrifugation step demonstrated that the ability of ompR, flhDC and inv mutants to invade HEp-2 cells was decreased to different extents (Fig. 3b).

However, the invasiveness of the ompR mutant was higher than that of the flhDC mutant. When Y. enterocolitica cells were centrifuged onto the monolayer to ensure bacterial check details contact with the host cells, the invasiveness of all applied mutants increased, but that of the ompR strain AR4, unlike the flhDC and inv mutants, actually exceeded the wild-type level (Fig. 3c). This suggests that upregulation

of invasin expression was responsible for the higher level of invasiveness of the ompR strain, although motility appeared to play a crucial role in the overall invasion of HEp-2 cells by the Y. enterocolitica strains. This is consistent with the results of previous studies, which showed that motility of Y. enterocolitica is required to initiate host cell invasion (Young et al., 2000). Complementation of the AR4 ompR Ku-0059436 in vitro mutation with the coding sequence of ompR cloned in vector pBBR1 MCS-3 (plasmid pBR3) restored the wild-type outer membrane porin profiles and inv expression (Brzostek et al., 2007). When tested for its ability to invade HEp-2 cells, the strain AR4/pBR3 exhibited increased invasion compared with the noncomplemented ompR mutant

(Fig. 3c). This was probably the effect of overproduction of OmpR and the increased expression of other OmpR-dependent adhesion–invasion factors. Forced contact between bacteria and host cells through centrifugation was found not to fully restore the adhesion–invasion defect of the nonmotile flhDC mutant DN1, which suggests the involvement of the FlhDC flagellar regulator in the modulation of virulence–invasion determinants other than flagella. Recently, it has acetylcholine been shown that FlhDC, besides its regulatory function in motility, may also act as a global regulator of Y. enterocolitica metabolism (Kapatral et al., 2004) and promote the secretion of virulence factors via the flagellar export apparatus (Young et al., 1999). Thus, apart from its effect on motility, the modulation of flhDC expression by OmpR is likely to have considerable implications for Y. enterocolitica physiology, including its adherent–invasive abilities. Biofilm formation is a feature of enteropathogenic yersiniae that is likely to play a role in pathogenesis. As reported previously for Yersinia species, several genes are potentially involved in biofilm formation (Hinnebusch, 2008; Kim et al.

It is likely that other OmpR-dependent adherence factors are missing in the ompR mutant. It has previously been shown that cells of the ompR mutant AR4 lack YompF and YompC porins in the outer membrane (Brzostek et al., 2007), and the latter protein may play a role in microbial attachment to eukaryotic cells (Brzostek & Raczkowska, 2007). These observations suggest that YompC might partially mediate the adhesion of Y. enterocolitica to HEp-2 cells. The results of invasion assays performed without the centrifugation step demonstrated that the ability of ompR, flhDC and inv mutants to invade HEp-2 cells was decreased to different extents (Fig. 3b).

However, the invasiveness of the ompR mutant was higher than that of the flhDC mutant. When Y. enterocolitica cells were centrifuged onto the monolayer to ensure bacterial Bleomycin purchase contact with the host cells, the invasiveness of all applied mutants increased, but that of the ompR strain AR4, unlike the flhDC and inv mutants, actually exceeded the wild-type level (Fig. 3c). This suggests that upregulation

of invasin expression was responsible for the higher level of invasiveness of the ompR strain, although motility appeared to play a crucial role in the overall invasion of HEp-2 cells by the Y. enterocolitica strains. This is consistent with the results of previous studies, which showed that motility of Y. enterocolitica is required to initiate host cell invasion (Young et al., 2000). Complementation of the AR4 ompR Selleck Everolimus mutation with the coding sequence of ompR cloned in vector pBBR1 MCS-3 (plasmid pBR3) restored the wild-type outer membrane porin profiles and inv expression (Brzostek et al., 2007). When tested for its ability to invade HEp-2 cells, the strain AR4/pBR3 exhibited increased invasion compared with the noncomplemented ompR mutant

(Fig. 3c). This was probably the effect of overproduction of OmpR and the increased expression of other OmpR-dependent adhesion–invasion factors. Forced contact between bacteria and host cells through centrifugation was found not to fully restore the adhesion–invasion defect of the nonmotile flhDC mutant DN1, which suggests the involvement of the FlhDC flagellar regulator in the modulation of virulence–invasion determinants other than flagella. Recently, it has PI-1840 been shown that FlhDC, besides its regulatory function in motility, may also act as a global regulator of Y. enterocolitica metabolism (Kapatral et al., 2004) and promote the secretion of virulence factors via the flagellar export apparatus (Young et al., 1999). Thus, apart from its effect on motility, the modulation of flhDC expression by OmpR is likely to have considerable implications for Y. enterocolitica physiology, including its adherent–invasive abilities. Biofilm formation is a feature of enteropathogenic yersiniae that is likely to play a role in pathogenesis. As reported previously for Yersinia species, several genes are potentially involved in biofilm formation (Hinnebusch, 2008; Kim et al.

(2009). Participants performed one block of 60 trials, comprising 40 ‘money trials’ and 20 ‘blank trials’, presented in randomized order. Money trials included 20 repetitions of a $5 bill and 20 repetitions of a 10 cents coin. Each trial began with a cue (a picture of a $5 bill or a 10 cents coin within a white rectangle; or an empty rectangle for blank trials) for 2 s, followed by a blank screen for 1 s (Fig. 2A). TMS was delivered

at only one time-point – this was 500 ms before the choice screen (like the ‘late’ period of Experiment 1). This was motivated by the finding in Experiment 1 (see below) that this time-point was the optimal one for eliciting an effect. After this, a choice screen appeared (as for Experiment 1) selleckchem and the participant selected the response. Some trials included a yellow border around the white rectangle during money stimulus presentation; on these trials, the participant was required

to say ‘yellow’ (see Experiment 2b below). Participants were informed that, at the end of the experiment, one of the money trials would be randomly selected and honored (i.e. participants get the money if they selected Yes). Participants were instructed to select Yes on both types of check details money trials (optimal choice for participants), as well as on the blank trials. Having the same response on all three types of trials ensured that any resulting differences in motor-evoked Nitroxoline potentials (MEPs) across these trials were dependent only on the monetary value of the trials, and not independently driven by differences in the required responses. The task structure was similar to

Experiment 2a (Fig. 2A), the only differences being that the choice screen was not presented and the participants did not have to move their fingers to press keys. To minimize the possibility of participants not paying attention to the screen (as no hand responses were required in this experiment), each trial included, with a 10% probability, a yellow border on the white rectangle containing the money cue. On these trials, the participants had to say the word ‘yellow’ as soon as they saw the border; they were instructed that failure to do so more than once would result in the cancellation of any monetary rewards they might otherwise receive from the experiment. To keep Experiments 2a and 2b similar, this additional feature and requirement was also included in Experiment 2a. Note that Experiment 2b did not have any manual response requirement. The only motor requirement was to report the occurrence of the yellow border on the 10% of trials in which this occurred. Participants were seated 50 cm in front of an iMac (19-inch monitor). The experiments were run using Matlab (MathWorks, Natick, MA, USA) and the PsychToolBox3 (http://www.psychtoolbox.org).

Among the extracellular proteins detected, cell wall hydrolases, muramidases, peptidoglycan-binding polypeptides, and a precursor of the collagen-binding A protein were identified. In addition, some moonlighting proteins, such as glyceraldehyde 3-phosphate dehydrogenase, were also found. selleck The bacterial lysis of the cultures was negligible, as can be deduced from the comparison of secreted protein/total protein profiles obtained by SDS-PAGE (Fig. 3c). Analysis of the relative electrophoretic mobility of the proteins recovered after binding experiments suggested that the surface proteins ABC transporter periplasmic protein, ornithine carbamoyltransferase, and a high-affinity

cystine-binding protein bound mucin (Fig. 4a). Also, the secreted Selleckchem ABT199 GAPDH of L. plantarum Li69 and Li70 and that of L. gasseri Lv19 bound mucin, as it did muramidase and putative extracellular protein

from L. plantarum Lv69 and Li70 (Fig. 4b). One of the tests considered as crucial by the FAO/WHO for the in vitro evaluation of potential probiotic candidates is their capacity to adhere to mucin and human epithelial cells, as well as their antagonism toward pathogen establishment (FAO/WHO, 2006). The eight most adherent Lactobacillus strains were selected, and their adhesion abilities to three cell lines, their capability of interfering with the adhesion of two vaginal pathogens to a model human cell line, and the identification of their extracellular proteins and their ability to bind mucin were established. Presence of typical intestinal lactobacilli, such as L. plantarum, in vaginal environment has been reported previously and related to the decreased risk of second bacterial vaginosis (Antonio et al., 2005). Besides, the vaginal epithelium is also covered by a protective layer of mucus, which is mainly composed of mucins as the intestinal one,

although no commercial vaginal mucin is available (Dasari et al., 2007). In this context, mucins produced in the gastrointestinal and vaginal epithelium are very different. In the gut, MUC2 is mainly produced by goblet cells (McGuckin et al., 2011), whereas in the vaginal epithelium, MUC1, MUC4, MUC5AC, MUC5B, or MUC6 is produced, depending on the location (Gipson et al., 1997). Regarding the adhesion experiments to human cell lines, the four intestinal isolates presented affinities to HT-29 cells in the order of the positive control L. plantarum 229V. Therefore, this is an especially valuable probiotic property that, join to their ability to resist bile salts and acid (data not shown), might allow the use of Lv67, Li68, and Li71 in restoration of the vaginal ecosystem through oral administration. Binding of lactobacilli or their secreted compounds may either hinder colonization of the epithelium by potential pathogens, or create a barrier between them and the mucosal cells, thus excluding direct contact with the underlying epithelium.

Among the extracellular proteins detected, cell wall hydrolases, muramidases, peptidoglycan-binding polypeptides, and a precursor of the collagen-binding A protein were identified. In addition, some moonlighting proteins, such as glyceraldehyde 3-phosphate dehydrogenase, were also found. see more The bacterial lysis of the cultures was negligible, as can be deduced from the comparison of secreted protein/total protein profiles obtained by SDS-PAGE (Fig. 3c). Analysis of the relative electrophoretic mobility of the proteins recovered after binding experiments suggested that the surface proteins ABC transporter periplasmic protein, ornithine carbamoyltransferase, and a high-affinity

cystine-binding protein bound mucin (Fig. 4a). Also, the secreted selleck screening library GAPDH of L. plantarum Li69 and Li70 and that of L. gasseri Lv19 bound mucin, as it did muramidase and putative extracellular protein

from L. plantarum Lv69 and Li70 (Fig. 4b). One of the tests considered as crucial by the FAO/WHO for the in vitro evaluation of potential probiotic candidates is their capacity to adhere to mucin and human epithelial cells, as well as their antagonism toward pathogen establishment (FAO/WHO, 2006). The eight most adherent Lactobacillus strains were selected, and their adhesion abilities to three cell lines, their capability of interfering with the adhesion of two vaginal pathogens to a model human cell line, and the identification of their extracellular proteins and their ability to bind mucin were established. Presence of typical intestinal lactobacilli, such as L. plantarum, in vaginal environment has been reported previously and related to the decreased risk of Morin Hydrate bacterial vaginosis (Antonio et al., 2005). Besides, the vaginal epithelium is also covered by a protective layer of mucus, which is mainly composed of mucins as the intestinal one,

although no commercial vaginal mucin is available (Dasari et al., 2007). In this context, mucins produced in the gastrointestinal and vaginal epithelium are very different. In the gut, MUC2 is mainly produced by goblet cells (McGuckin et al., 2011), whereas in the vaginal epithelium, MUC1, MUC4, MUC5AC, MUC5B, or MUC6 is produced, depending on the location (Gipson et al., 1997). Regarding the adhesion experiments to human cell lines, the four intestinal isolates presented affinities to HT-29 cells in the order of the positive control L. plantarum 229V. Therefore, this is an especially valuable probiotic property that, join to their ability to resist bile salts and acid (data not shown), might allow the use of Lv67, Li68, and Li71 in restoration of the vaginal ecosystem through oral administration. Binding of lactobacilli or their secreted compounds may either hinder colonization of the epithelium by potential pathogens, or create a barrier between them and the mucosal cells, thus excluding direct contact with the underlying epithelium.

We conducted a cross-sectional survey of women attending the HIV clinic between May and December 2011. Women were excluded if they were younger than 18 years, were accompanied by an adult or child aged 4 years or older, or were unable to give informed consent because of poor physical or mental health. We also excluded women with psychological conditions that the clinic’s psychology team felt placed them at high risk of severe distress as a consequence of participating. All participants were offered support from health Entinostat supplier advisors and psychologists.

They were also provided with information on local and national domestic violence agencies and generic HIV support agencies. Participants were asked whether they would like their clinic doctor to be provided with a copy of the questionnaire. If information was disclosed to the clinical team that raised serious concerns about the safety of the woman or any children, local clinic policies were followed for safeguarding children and vulnerable adults. Participants completed a standardized, structured questionnaire. It included the four questions in the HARK tool, which seeks to identify women experiencing physical, sexual or emotional IPV in the last year (see Fig. 1) [28]. The HARK tool was adapted from the Abuse Assessment Screen [29] and was validated against the Composite Abuse Scale [30]. We asked about experiences of IPV in the last

year and adapted the questions to ask about abuse experienced more than 1 year ago. We also asked about factors that have been associated with IPV

in previous studies, including age, ethnicity, level of educational attainment, employment, E7080 purchase immigration and marital status, parity, age at sexual debut, transactional sex, previous STIs, alcohol and substance misuse, history of mental health disorder, and past childhood physical and sexual abuse. The questionnaire was designed in consultation with experts in the field of IPV research and members of the clinic patient forum, and was piloted in 10 women. Trained Phosphoprotein phosphatase medical telephone interpreters were used with participants who did not speak sufficient English. For participants with poor literacy, the questionnaire was administered face to face by members of the research team. Relevant clinical data were obtained from medical records. IPV within the past 1 year was defined as having answered “yes” to at least one of the four HARK questions, with the experience occurring specifically within the past 1 year. We adapted the HARK questions to ask about lifetime IPV, and this was defined as answering “yes” to at least one of the four HARK adapted questions, with the experience having occurred at any point during a participant’s lifetime. Ethnicity was based on self-reported ethnicity and categorized as “African-born Black”, “other Black” (of Black ethnicity and born outside sub-Saharan Africa), “White” and “other” (comprising Asian and other ethnicities).